> Would this original still exist today? Or would mutations have gotten rid of the original strand/chromosome a while ago?

Not a chance.

But what is the oldest 'surviving' hunk o' DNA still floating about? Well, let's interpret that in three ways:

i) Oldest DNA in a living organism:

As far as the actual nucleotide molecules within a given genomic position are concerned, the turnover rate is incredibly high - at least half is 'new' for that double-stranded sequence with every division cycle, on the order of at most, usually, days for most metabolically active tissues in most organisms. Coupled with DNA damage repair, nucleotide salvage, and other mechanisms recycling and replacing individual nucleotides as and when, this is pure conjecture* but I'd say it's almost a statistical certainty that no given single nucleotide will be passed on inter-generationally and remain exactly where it was in sequence.

This means that, with the most conservative estimates, I'd imagine the 'oldest' stretch of DNA on Earth that has remained atomically conserved in a living beastie is going to be something like a teeny stretch of several adenosines tucked away in a quiescent cell in some long-lived deep sea clam, or something. A few decades, maybe one or two hundred years at most?

Who knows, to be honest. Not very long in any case!

EDIT: Oh, wait. I totally forgot about plants. In which case, maybe swap clam for some old gnarled bristlecone somewhere. Saying that, IIRC there's proportionally more live tissue turnover in modular organisms like plants compared to unitary animals (i.e. most of the substance of a tree is dead xylem and excreted lignin; the 'alive' bit is the relatively thin film of phloem in the bark over the surface, constantly replicating outwards). I really don't know. Still same-ish order of magnitudes in years in any case.

^(^* I tried doing a quick sweep of the literature to find decent replacement rates; thought the radioisotope labelling stuff would be fruitful, but alas, nothing. If anyone has a source for molecular (not sequence)^) ^(replacement rates, we'd be able to narrow this down to an informed range, instead of pure speculation.)

ii) Oldest DNA on Earth:

It's different for DNA stuck in dead things though. Without biological processes to generate nucleotide turnover, things are more promising, though we're still at the mercy of the chemical half-life of DNA which, condition dependent, has been calculated to be approximately ~512 years (i.e. every 512 years, the bonds in half the DNA in a given sample are broken down). This sets a maximum upper bound in the low millions of years (about ~6ish for 1% DNA to remain); indeed, the oldest fragment of ancient DNA we've sequenced to date is from a mammoth molar, approximated at being ~1.6 million years old (though including error up to a lowest confidence score at most ~2.25ish). Anything much older will likely have degraded to useless unsequence-able mush.

So yup, there's probably a bit of post-DNA nucleotide residue in some mummified subfossil somewhere that'll be a few million years old.

ii) Oldest conserved DNA sequence:

If we twist the question a little and forget about the actual physical DNA, but rather what it encodes, then we're really upping the numbers here. Many genes are super conserved across all life, as they perform functions which are foundational for all other biological processes (e.g. protein or ATP production). Assuming the most conserved are the oldest, candidates for 'oldest sequence' are the RNA sequences for the 16S and 23S ribosomal subcomponents, plus assorted tRNA sequences (all involved in converting RNA into protein), and then a bunch of genomic DNA genes for ATP-binding cassette (ABC) transporters, which are crucial for moving things in and out of membranes. The most conserved of these is within yecC, the human homolog being the TAP2 gene. In which case, the oldest bit of DNA sequence in your body right now, having been bobbing about in the last universal common ancestor of all extant life (LUCA), at least ~3.9 billion years ago, is this:

> AAAGGAGTCCAAATGTCTGGAGGACAGAAGCAAAGAAATTGCAATTGCTCGAGCTTTGATCCGTGATCCACGTGTTCTGATCATATACGACGAGCCAACTTCCGGACTCGAC

Ooooh. Check out them sexy Cs.

The originals are long gone, but the copies survive!

References:

Allentoft, M.E., Collins, M., Harker, D. et al. (2012) The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils. Proceedings of the Royal Society B: Biological Sciences. 279 (1748)

Betts, H.C., Puttick, M.N., Clark, J.W., Williams, T.A., Donoghue, P.C.J. & Pisani, D. (2018) Integrated genomic and fossil evidence illuminates life’s early evolution and eukaryote origins. Nature Ecology & Evolution. 2 (10), 1556-1562

Isenbarger, T.A., Carr, C.E., Johnson, S.S., Finney, M., Church, G.M., Gilbert, W., Zuber, M.T. & Ruvkun, G. (2008) The most conserved genome segments for life detection on Earth and other planets. Origins of Life and Evolution of Biospheres. 38 (6), 517-533

Lane, A.N. & Fan, T.W.M. (2015) Regulation of mammalian nucleotide metabolism and biosynthesis. Nucleic Acid Research. 43 (4), 2466-2485

Valk, van der T., Pecnerova, P., Diez-del-Molino, D.D. et al. (2021) Million-year old DNA sheds light on the genomic history of mammoths. Nature. 591, 265-269